E-ISSN 0976-2779 | ISSN 0975-8453
 

Review Article 


Characterization of Lactic Acid Bacteria and Determination of Antimicrobial Activity in Dadih from Air Dingin Alahan Panjang District, Solok Regency-West Sumatera

Harnavi Harun, Yan Wirasti, Bambang Purwanto, Endang Purwati.

Abstract
Traditional Indonesian fermented foods have been studied as potential probiotics, for example dadiah from West Sumatera are made by fermenting buffalo milk in bamboo tubes. But the potential of halal probiotics isolated from Air Dingin District, West Sumatra (Indonesia) has not been studied. The purpose of this study was to determine the potential of halal probiotic lactic acid bacteria (LAB) Lactobacillus plantarum strain 8m-21 isolation from dadiah in Air Dingin Alahan Panjang District, Solok Regency West Sumatera (Indonesia) against to pathogenic bacteria and antimicrobial activity. Previously lactic acid bacteria Lactobacillus plantarum had been isolationand molecular identification used I6S rRNA with Forward (27F AGAGTTTGATCCTGGCTGAG) and Reverse primer (1492R; GTTTACCTTACGACTT). In this study we analyzed the probiotics have antimicrobial activity against pathogenic bacteria Escherichia coli O157. The results showed that Lactobacillus plantarum strain 8m-21 from Air Dingin dadiah isolates have probiotic properties because they have antimicrobial properties which able to inhibit Escherichia coli, aerob (pathogenic) bacteria and have highest antimicrobial with 20.25 mm inhibition than other sintetic antibiotics.

Key words: Antimicrobial, Dadiah, Probiotic, and Lactobacillus plantarum


 
ARTICLE TOOLS
Abstract
PDF Fulltext
How to cite this articleHow to cite this article
Citation Tools
Related Records
 Articles by Harnavi Harun
Articles by Yan Wirasti
Articles by Bambang Purwanto
Articles by Endang Purwati
on Google
on Google Scholar


How to Cite this Article
Pubmed Style

Harnavi Harun, Yan Wirasti, Bambang Purwanto, Endang Purwati. Characterization of Lactic Acid Bacteria and Determination of Antimicrobial Activity in Dadih from Air Dingin Alahan Panjang District, Solok Regency-West Sumatera. SRP. 2020; 11(3): 583-586. doi:10.31838/srp.2020.3.76


Web Style

Harnavi Harun, Yan Wirasti, Bambang Purwanto, Endang Purwati. Characterization of Lactic Acid Bacteria and Determination of Antimicrobial Activity in Dadih from Air Dingin Alahan Panjang District, Solok Regency-West Sumatera. http://www.sysrevpharm.org//?mno=95998 [Access: June 01, 2020]. doi:10.31838/srp.2020.3.76


AMA (American Medical Association) Style

Harnavi Harun, Yan Wirasti, Bambang Purwanto, Endang Purwati. Characterization of Lactic Acid Bacteria and Determination of Antimicrobial Activity in Dadih from Air Dingin Alahan Panjang District, Solok Regency-West Sumatera. SRP. 2020; 11(3): 583-586. doi:10.31838/srp.2020.3.76



Vancouver/ICMJE Style

Harnavi Harun, Yan Wirasti, Bambang Purwanto, Endang Purwati. Characterization of Lactic Acid Bacteria and Determination of Antimicrobial Activity in Dadih from Air Dingin Alahan Panjang District, Solok Regency-West Sumatera. SRP. (2020), [cited June 01, 2020]; 11(3): 583-586. doi:10.31838/srp.2020.3.76



Harvard Style

Harnavi Harun, Yan Wirasti, Bambang Purwanto, Endang Purwati (2020) Characterization of Lactic Acid Bacteria and Determination of Antimicrobial Activity in Dadih from Air Dingin Alahan Panjang District, Solok Regency-West Sumatera. SRP, 11 (3), 583-586. doi:10.31838/srp.2020.3.76



Turabian Style

Harnavi Harun, Yan Wirasti, Bambang Purwanto, Endang Purwati. 2020. Characterization of Lactic Acid Bacteria and Determination of Antimicrobial Activity in Dadih from Air Dingin Alahan Panjang District, Solok Regency-West Sumatera. Systematic Reviews in Pharmacy, 11 (3), 583-586. doi:10.31838/srp.2020.3.76



Chicago Style

Harnavi Harun, Yan Wirasti, Bambang Purwanto, Endang Purwati. "Characterization of Lactic Acid Bacteria and Determination of Antimicrobial Activity in Dadih from Air Dingin Alahan Panjang District, Solok Regency-West Sumatera." Systematic Reviews in Pharmacy 11 (2020), 583-586. doi:10.31838/srp.2020.3.76



MLA (The Modern Language Association) Style

Harnavi Harun, Yan Wirasti, Bambang Purwanto, Endang Purwati. "Characterization of Lactic Acid Bacteria and Determination of Antimicrobial Activity in Dadih from Air Dingin Alahan Panjang District, Solok Regency-West Sumatera." Systematic Reviews in Pharmacy 11.3 (2020), 583-586. Print. doi:10.31838/srp.2020.3.76



APA (American Psychological Association) Style

Harnavi Harun, Yan Wirasti, Bambang Purwanto, Endang Purwati (2020) Characterization of Lactic Acid Bacteria and Determination of Antimicrobial Activity in Dadih from Air Dingin Alahan Panjang District, Solok Regency-West Sumatera. Systematic Reviews in Pharmacy, 11 (3), 583-586. doi:10.31838/srp.2020.3.76